pGem-LP1-loxP-bar-lox2272-71
(Plasmid #168785)

• Purpose: Vector to create landing pad 1 (LP1) by homologous recombination in Aspergillus nidulans ΔSt site. The strain A. nidulans LP1 is used for recombinase mediated chromosomal integration.
• Depositing Lab: Yit Heng Chooi
• Publication: Roux et al ACS Synth Biol. 2022 Feb 16. doi: 10.1021/acssynbio.1c00458.

Backbone

• Vector backbone: pGEM
• Backbone size w/o insert (bp): 3033
• Total vector size (bp): 6671
• Vector type: Cre/Lox, Synthetic Biology
• Selectable markers: Basta

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: bar
• Alt name: Glufosinate/basta-resistance
• Species: Synthetic; Streptomyces hygroscopicus
• Insert Size (bp): 939

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GACGTGGGTTTCTGGCAG

Gene/Insert 2

• Gene/Insert name: Homology arm (ChrIV_A_nidulans_FGSC_A4:2736011,2737053)
• Species: Aspergillus nidulans
• Insert Size (bp): 1040

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CAGGAAACAGCTATGAC

Gene/Insert 3

• Gene/Insert name: Homology arm (ChrIV_A_nidulans_FGSC_A4:2790295,2791327)
• Species: Aspergillus nidulans
• Insert Size (bp): 1033

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GACGTGGGTTTCTGGCAG

Gene/Insert 4

• Gene/Insert name: loxP
• Species: Synthetic
• Insert Size (bp): 34

Cloning Information for Gene/Insert 4

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GACGTGGGTTTCTGGCAG

Gene/Insert 5

• Gene/Insert name: lox2272-71
• Species: Synthetic
• Insert Size (bp): 34

Cloning Information for Gene/Insert 5

• Cloning method: Restriction Enzyme
• 5′ cloning site: PmII (destroyed during cloning)
• 3′ cloning site: AatII (destroyed during cloning)
• 5′ sequencing primer: AATGCTTCGAGGTCCTGTATTGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Vector used to create Aspergillus nidulans parental strains with LP1 by polyethylene glycol (PEG)-calcium-based transformation with NotI linearized vector pGemLP1-loxP-bar-Lox2272-71 containing 1 kb homology regions at 5′ and 3′ of the floxed bar to facilitate homologous recombination in A. nidulans LO8030 ∆St locus. Colonies are selected for resistance to glufosinate extracted from Basta.