pGem-PgpdA-Cre-TtrpC
(Plasmid #168784)

• Purpose: Helper vector for the transient expression of Cre recombinase in filamentous fungi. Not replicative in fungi.
• Depositing Lab: Yit Heng Chooi
• Publication: Roux et al ACS Synth Biol. 2022 Feb 16. doi: 10.1021/acssynbio.1c00458.

Backbone

• Vector backbone: pGem
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 2812
• Total vector size (bp): 4924
• Vector type: Cre/Lox, Synthetic Biology ; Expression in filamentous fungi

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cre
• Species: Synthetic; P1 coliphage
• Insert Size (bp): 1032
• Promoter: PgpdA

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CCCAGTCACGACGTTGTAAAACG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For transient Cre recombinase expression in Aspergillus nidulans, we created the helper vector pGem-PgpdA-Cre-TtrpC unable to replicate in filamentous fungi. The helper vector encodes a cassette for constitutive expression of Cre under the promoter gpdA (PgpdA) and the terminator trpC . As the recipient strain A. nidulans LP1 carries nkuA∆, which minimises random integration events, the helper vector presumably would be lost during fungal growth