Vimentin-DiB-RM
(Plasmid
#168783)
-
PurposeVimentin - DiB-RM fusion protein
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 168783 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneVimentin-Citrine
- Backbone size w/o insert (bp) 3948
- Total vector size (bp) 5850
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVimentin-DiB-RM
-
SpeciesSynthetic
-
Insert Size (bp)1902
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CAAGTTAACAACAACAATTGCAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Vimentin-DiB-RM was a gift from Jens Meiler (Addgene plasmid # 168783 ; http://n2t.net/addgene:168783 ; RRID:Addgene_168783) -
For your References section:
Computational redesign of a fluorogen activating protein with Rosetta. Bozhanova NG, Harp JM, Bender BJ, Gavrikov AS, Gorbachev DA, Baranov MS, Mercado CB, Zhang X, Lukyanov KA, Mishin AS, Meiler J. PLoS Comput Biol. 2021 Nov 8;17(11):e1009555. doi: 10.1371/journal.pcbi.1009555. eCollection 2021 Nov. 10.1371/journal.pcbi.1009555 PubMed 34748541