pUDE1084
(Plasmid #168500)

• Purpose: expression of T7RNA polymerase and CRISPR endonunclease Fncas12a
• Depositing Lab: Jean-Marc Daran
• Publication: Randazzo et al CRISPR J. 2021 Apr 23. doi: 10.1089/crispr.2020.0028.

Backbone

• Vector backbone: pGGKd034
• Backbone size w/o insert (bp): 5890
• Total vector size (bp): 13273
• Vector type: CRISPR
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Fncas12a
• Species: Synthetic; Francisella tularensis subsp. novicida U112
• Insert Size (bp): 4038
• Promoter: TEF1

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGCTCATAGCTTCAAAATGTTTCTACTCC

Gene/Insert 2

• Gene/Insert name: T7RNA polymerase
• Species: Bacteriophage T7
• Insert Size (bp): 2682
• Promoter: TDH3

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTACTAGCGTTGAATGTTAGCG

Resource Information

• Supplemental Documents:
  • pUDE1084.gbk
• A portion of this plasmid was derived from a plasmid made by: Fncpf1 has been cloned from the Addgene plasmid #69976 (pY004) harbouring the human codon-optimized F. novicida cpf1 tagged with C-terminal nuclear localization signal (NLS) and 3xHA tag. (Zetsche B., Gootenberg J.S., Abudayyeh O.O., Slaymaker I.M., Makarova K.S., Essletzbichler P., Volz S.E., Joung J., van der Oost J., Regev A.et al. Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell. 2015; 163:759–771.) The T7 RNA polymerase has been cloned from the Addgene plasmid #33152 (pRS315-nls-T7-RNAP) harbouring the NLS-T7RNApol gene (Dower, K. and Rosbash, M. (2002) T7 RNA polymerase-directed transcripts are processed in yeast and link 39 end formation to mRNA nuclear export. RNA, 8, 686-697)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry