pLM1110_LEU2
(Plasmid #168460)

• Purpose: Big-IN Payload yeast assembly vector. Encodes LEU2 yeast selectable marker and components for bacterial copy number induction. Contains a mammalian transient (backbone) GFP-T2A-BSD selection cassette.
• Depositing Lab: Jef Boeke
• Publication: Brosh et al Proc Natl Acad Sci U S A. 2021 Mar 9;118(10). pii: 2023952118. doi: 10.1073/pnas.2023952118.

Backbone

• Vector backbone: custom
• Backbone manufacturer: Maurano and Boeke labs, The Center for Synthetic Regulatory Genomics, NYU Langone Health
• Vector type: Synthetic Biology ; Yeast assembly vector for Big-IN payloads
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): TransforMax EPI300
• Growth instructions: Copy number induction is recommended for high yield preps. See Lucigen’s growth and copy number induction protocol for TransforMax EPI300 cells.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: mRFP1
• Insert Size (bp): 678

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: TGATCTCGCCCCGAGAACTG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry