Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGEX-5X-3-SARS-CoV-2-3CL
(Plasmid #168457)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 168457 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Login to view industry pricing.

Backbone

  • Vector backbone
    pGEX-5X-3
  • Backbone manufacturer
    GE
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SARS-CoV-2 3CL protease
  • Alt name
    SARS-CoV-2 nsp5
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    921
  • Entrez Gene
    ORF1ab (a.k.a. GU280_gp01)
  • Promoter tac
  • Tag / Fusion Protein
    • GST (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATATAGCATGGCCTTTGCAG
  • 3′ sequencing primer GAGCTGCATGTGTCAGAGGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX-5X-3-SARS-CoV-2-3CL was a gift from Alejandro Chavez & David Ho & Sho Iketani (Addgene plasmid # 168457 ; http://n2t.net/addgene:168457 ; RRID:Addgene_168457)
  • For your References section:

    Lead compounds for the development of SARS-CoV-2 3CL protease inhibitors. Iketani S, Forouhar F, Liu H, Hong SJ, Lin FY, Nair MS, Zask A, Huang Y, Xing L, Stockwell BR, Chavez A, Ho DD. Nat Commun. 2021 Apr 1;12(1):2016. doi: 10.1038/s41467-021-22362-2. 10.1038/s41467-021-22362-2 PubMed 33795671