-
PurposeBacterial codon optimized expression vector for SARS-CoV-2 3CL protease.
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 168457 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepGEX-5X-3
-
Backbone manufacturerGE
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSARS-CoV-2 3CL protease
-
Alt nameSARS-CoV-2 nsp5
-
SpeciesH. sapiens (human)
-
Insert Size (bp)921
-
Entrez GeneORF1ab (a.k.a. GU280_gp01)
- Promoter tac
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATATAGCATGGCCTTTGCAG
- 3′ sequencing primer GAGCTGCATGTGTCAGAGGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX-5X-3-SARS-CoV-2-3CL was a gift from Alejandro Chavez & David Ho & Sho Iketani (Addgene plasmid # 168457 ; http://n2t.net/addgene:168457 ; RRID:Addgene_168457) -
For your References section:
Lead compounds for the development of SARS-CoV-2 3CL protease inhibitors. Iketani S, Forouhar F, Liu H, Hong SJ, Lin FY, Nair MS, Zask A, Huang Y, Xing L, Stockwell BR, Chavez A, Ho DD. Nat Commun. 2021 Apr 1;12(1):2016. doi: 10.1038/s41467-021-22362-2. 10.1038/s41467-021-22362-2 PubMed 33795671