HyPer7.2DAAO-mito
(Plasmid #168304)

• Purpose: Chemogenetic fluorescent H2O2 reporter targeted to the mitochondria
• Depositing Lab: Thomas Michel
• Publication: Saeedi Saravi et al Redox Biol. 2020 Sep;36:101605. doi: 10.1016/j.redox.2020.101605. Epub 2020 Jun 16.

Backbone

• Vector backbone: pCS2+
• Backbone size w/o insert (bp): 4095
• Total vector size (bp): 6868
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HyPer7.2DAAO-mito
• Species: Synthetic
• Insert Size (bp): 2784
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: CGCGATGGCTGCCAAGTACA
• 3′ sequencing primer: TGACCATGATTACGCCAAGC

Resource Information

• Supplemental Documents:
  • HyPer7.2DAAO-mito.gbk
• A portion of this plasmid was derived from a plasmid made by: Partial sequence (HyPer7.2) was a gift from Vsevolod Belousov Lab.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry