pET28a-TEV-TBP6.9F34MF37MF77M
(Plasmid #168268)

• Purpose: Expresses human TBP6.9 with the F34M/F37M/F77M triple mutant
• Depositing Lab: Joseph Wedekind
• Publication: Srivastava et al Crystals (Basel). 2021 Mar;11(3). doi: 10.3390/cryst11030273. Epub 2021 Mar 10.

Backbone

• Vector backbone: pET28a-TEV
• Backbone manufacturer: GenScript
• Backbone size w/o insert (bp): 5400
• Total vector size (bp): 5730
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TBP6.9
• Alt name: U1A mutant
• Alt name: TBP6.9
• Alt name: U1 small nuclear ribonucleoprotein A RRM1
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 324
• Mutation: changed F34M, F37M and F77M
• Promoter: T7 promotor
• Tag / Fusion Protein:
  • 6xHis tag N-terminus, TEV protease cleavage site (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: This is a synthetic gene cloned by fee for service from GenScript.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry