Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET28a-TEV-TBP6.9F34MF37MF77M
(Plasmid #168268)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 168268 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET28a-TEV
  • Backbone manufacturer
    GenScript
  • Backbone size w/o insert (bp) 5400
  • Total vector size (bp) 5730
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TBP6.9
  • Alt name
    U1A mutant
  • Alt name
    TBP6.9
  • Alt name
    U1 small nuclear ribonucleoprotein A RRM1
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    324
  • Mutation
    changed F34M, F37M and F77M
  • Promoter T7 promotor
  • Tag / Fusion Protein
    • 6xHis tag N-terminus, TEV protease cleavage site (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This is a synthetic gene cloned by fee for service from GenScript.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28a-TEV-TBP6.9F34MF37MF77M was a gift from Joseph Wedekind (Addgene plasmid # 168268 ; http://n2t.net/addgene:168268 ; RRID:Addgene_168268)
  • For your References section:

    Affinity and Structural Analysis of the U1A RNA Recognition Motif with Engineered Methionines to Improve Experimental Phasing. Srivastava Y, Bonn-Breach R, Chavali SS, Lippa GM, Jenkins JL, Wedekind JE. Crystals (Basel). 2021 Mar;11(3). doi: 10.3390/cryst11030273. Epub 2021 Mar 10. 10.3390/cryst11030273 PubMed 33777416