pET28a-TEV-U1AF37MF77M
(Plasmid
#168267)
-
PurposeExpresses human dmU1A with the F37M/F77M double mutant
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 168267 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET28a-TEV
-
Backbone manufacturerGenScript
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 5730
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameU1A RRM1 crystallization module
-
Alt nameU1A F37M/F77M double mutant
-
Alt namedmU1A F37M/F77M double mutant
-
Alt nameU1 small nuclear ribonucleoprotein A RRM1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)324
-
Mutationchanged F37M and F77M
-
Entrez GeneSNRPA (a.k.a. Mud1, U1-A, U1A)
- Promoter T7 promotor
-
Tag
/ Fusion Protein
- 6xHis tag N-terminus, TEV protease cleavage site (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ndeI (not destroyed)
- 3′ cloning site xhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThis is a synthetic gene cloned by fee for service from GenScript.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a-TEV-U1AF37MF77M was a gift from Joseph Wedekind (Addgene plasmid # 168267 ; http://n2t.net/addgene:168267 ; RRID:Addgene_168267) -
For your References section:
Affinity and Structural Analysis of the U1A RNA Recognition Motif with Engineered Methionines to Improve Experimental Phasing. Srivastava Y, Bonn-Breach R, Chavali SS, Lippa GM, Jenkins JL, Wedekind JE. Crystals (Basel). 2021 Mar;11(3). doi: 10.3390/cryst11030273. Epub 2021 Mar 10. 10.3390/cryst11030273 PubMed 33777416