Tol2-LyzC-RacFRET-U6ac-rac2 guides
(Plasmid
#168248)
-
Purpose"label active Rac under Rac2 neutrophil-specific knockout background"
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 168248 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepME-GFP
-
Modifications to backboneremove GFP and add RacFRET
-
Vector typeZebrafish expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRacFRET
-
gRNA/shRNA sequencegggccaatgcgagaccctgt/gggctgtatcccagagtccc
- Promoter LyzC
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GGTCGACTCGCCACCATGGTGAGCAAGGGCGAGG
- 3′ sequencing primer CTCCACCGCGGCCGCTTACATAATTACACACTTTGTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Reference for the RacFRET (Raichu-Rac1) element:
D. L. Graham, P. N. Lowe, and P. A. Chalk. A method to measure the interaction of Rac/Cdc42 with their binding partners using fluorescence resonance energy transfer between mutants of green fluorescent protein. Anal.Biochem. 296:208-217, 2001.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Tol2-LyzC-RacFRET-U6ac-rac2 guides was a gift from Qing Deng (Addgene plasmid # 168248 ; http://n2t.net/addgene:168248 ; RRID:Addgene_168248) -
For your References section:
A robust and flexible CRISPR/Cas9-based system for neutrophil-specific gene inactivation in zebrafish. Wang Y, Hsu AY, Walton EM, Park SJ, Syahirah R, Wang T, Zhou W, Ding C, Lemke AP, Zhang G, Tobin DM, Deng Q. J Cell Sci. 2021 Apr 15;134(8). pii: 237799. doi: 10.1242/jcs.258574. Epub 2021 Apr 22. 10.1242/jcs.258574 PubMed 33722979