Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSP014
(Plasmid #168224)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 168224 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBAD-TOPO
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4127
  • Total vector size (bp) 8313
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    eatA
  • Species
    E. coli
  • Insert Size (bp)
    4092
  • GenBank ID
    AY163491 AY163491
  • Promoter araBAD

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • 3′ sequencing primer ATTTAATCTGTATCAGGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSP014 was a gift from James Fleckenstein (Addgene plasmid # 168224 ; http://n2t.net/addgene:168224 ; RRID:Addgene_168224)
  • For your References section:

    Identification and molecular characterization of EatA, an autotransporter protein of enterotoxigenic Escherichia coli. Patel SK, Dotson J, Allen KP, Fleckenstein JM. Infect Immun. 2004 Mar;72(3):1786-94. doi: 10.1128/iai.72.3.1786-1794.2004. 10.1128/iai.72.3.1786-1794.2004 PubMed 14977988
Commonly requested with: