pMEH371 CD63 HA
(Plasmid #168220)

• Purpose: Mammalian expression of tetraspanin CD63 fused to a C-terminal HA tag
• Depositing Lab: Joshua Leonard
• Publication: Hung et al J Extracell Vesicles. 2016 May 13;5:31027. doi: 10.3402/jev.v5.31027. eCollection 2016.

Backbone

• Vector backbone: pcDNA 3.1+ Hygro
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 5520
• Total vector size (bp): 6285
• Vector type: Mammalian Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CD63
• Species: H. sapiens (human)
• Insert Size (bp): 765
• Entrez Gene: CD63 (a.k.a. AD1, HOP-26, ME491, MLA1, OMA81H, Pltgp40, TSPAN30)
• Promoter: CMV
• Tag / Fusion Protein:
  • HA (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CMVF CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: BGHR TAGAAGGCACAGTCGAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry