pMEH361 Hspa8 MS2 HA
(Plasmid #168218)

• Purpose: Mammalian expression of heat shock 70 kDa protein 8 fused to the MS2 dimer and C-terminal HA tag
• Depositing Lab: Joshua Leonard
• Publication: Hung et al J Extracell Vesicles. 2016 May 13;5:31027. doi: 10.3402/jev.v5.31027. eCollection 2016.

Backbone

• Vector backbone: pcDNA 3.1+ Hygro
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 5573
• Total vector size (bp): 8276
• Vector type: Mammalian Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Hspa8
• Species: H. sapiens (human)
• Insert Size (bp): 2703
• Promoter: CMV
• Tags / Fusion Proteins:
  • MS2 dimer (C terminal on insert)
  • HA (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CMVF CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: BGHR TAGAAGGCACAGTCGAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry