Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMEH305 HA NLS SpCas9 3x high affinity MS2 loops
(Plasmid #168216)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 168216 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGIPZ
  • Backbone manufacturer
    Open Biosciences
  • Backbone size w/o insert (bp) 9593
  • Total vector size (bp) 13838
  • Modifications to backbone
    Includes 3 high affinity MS2 loops downstream of WPRE
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Bleocin (Zeocin), 100 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SV40 NLS SpCas9
  • Species
    S. pyogenes
  • Insert Size (bp)
    4245
  • Promoter CMV
  • Tags / Fusion Proteins
    • SV40 NLS (N terminal on insert)
    • HA (N terminal on insert)
    • nucleoplasmin NLS (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer CMVF CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer WPRE R ggagcaacatagttaagaatacc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Hygromycin selection marker is not within the LTRs

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMEH305 HA NLS SpCas9 3x high affinity MS2 loops was a gift from Joshua Leonard (Addgene plasmid # 168216 ; http://n2t.net/addgene:168216 ; RRID:Addgene_168216)
  • For your References section:

    A platform for actively loading cargo RNA to elucidate limiting steps in EV-mediated delivery. Hung ME, Leonard JN. J Extracell Vesicles. 2016 May 13;5:31027. doi: 10.3402/jev.v5.31027. eCollection 2016. PubMed 27189348