pMEH280 NLS dTomato 3x high affinity MS2 loops
(Plasmid #168211)

• Purpose: Mammalian expression of nuclear-localized dTomato with 3 high affinity MS2 loops
• Depositing Lab: Joshua Leonard
• Publication: Hung et al J Extracell Vesicles. 2016 May 13;5:31027. doi: 10.3402/jev.v5.31027. eCollection 2016.

Backbone

• Vector backbone: pGIPZ
• Backbone manufacturer: Open Biosciences
• Backbone size w/o insert (bp): 9471
• Total vector size (bp): 10209
• Modifications to backbone: Includes 3 high affinity MS2 loops downstream of WPRE
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin and Bleocin (Zeocin), 100 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NLS dTomato
• Species: Synthetic
• Insert Size (bp): 738
• Promoter: CMV
• Tag / Fusion Protein:
  • NLS (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: N/A (unknown if destroyed)
• 5′ sequencing primer: CMVF CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: WPRE R ggagcaacatagttaagaatacc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Hygromycin selection marker is not within the LTRs