pAN7.1
(Plasmid #168129)

• Purpose: Expresses hygR from the gdpA promoter with a trpC terminator. Typically used in Aspergillus species as a selection marker for resistance to hygromycin.
• Depositing Lab: Michael Bromley
• Publication: Zhao et al Curr Protoc Microbiol. 2019 Sep;54(1):e88. doi: 10.1002/cpmc.88.

Backbone

• Vector backbone: pUC19
• Backbone size w/o insert (bp): 2648
• Total vector size (bp): 6749
• Vector type: Synthetic Biology
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: HygR gene
• Alt name: Hph
• Species: Synthetic; Aspergillus fumigatus
• Insert Size (bp): 4101
• Promoter: gdpA

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CAGGAAACAGCTATGACCATG
• 3′ sequencing primer: ACTGGCCGTCGTTTTACA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Peter Punt and Arthur Ram, obtained with permission from their original work in 1987.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry