pRECLV103_PGBD5_B
(Plasmid
#168053)
-
PurposeLentiviral expression vector for fusion of GFP with human PGBD5, NCBI: NM_001258311.1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 168053 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepReceiver-Lv103
-
Backbone manufacturerGenecopeia
- Backbone size w/o insert (bp) 8721
- Total vector size (bp) 10296
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePGBD5
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1575
-
GenBank IDNM_001258311.1
-
Entrez GenePGBD5
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer agaacatggtggtgcagaca
- 3′ sequencing primer TACAAGGTCCAGCCCTTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRECLV103_PGBD5_B was a gift from Alex Kentsis (Addgene plasmid # 168053 ; http://n2t.net/addgene:168053 ; RRID:Addgene_168053) -
For your References section:
PGBD5 promotes site-specific oncogenic mutations in human tumors. Henssen AG, Koche R, Zhuang J, Jiang E, Reed C, Eisenberg A, Still E, MacArthur IC, Rodriguez-Fos E, Gonzalez S, Puiggros M, Blackford AN, Mason CE, de Stanchina E, Gonen M, Emde AK, Shah M, Arora K, Reeves C, Socci ND, Perlman E, Antonescu CR, Roberts CWM, Steen H, Mullen E, Jackson SP, Torrents D, Weng Z, Armstrong SA, Kentsis A. Nat Genet. 2017 May 15. doi: 10.1038/ng.3866. 10.1038/ng.3866 PubMed 28504702