-
PurposegRNA entry vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 167936 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneKLV2
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameU6-gRNA backbone
-
gRNA/shRNA sequenceempty
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer gacagatccattcgattagtg
- 3′ sequencing primer GAGCCAGTACACGACATCAC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Modified from pKLV2-U6gRNA5(Empty)-PGKBFP2AGFP-W (Addgene Plasmid #67979).
Please visit https://www.biorxiv.org/content/10.1101/2020.05.04.076067v2 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-U6-gRNA-EF1a-EGFP-CAAX was a gift from Emma Rawlins (Addgene plasmid # 167936 ; http://n2t.net/addgene:167936 ; RRID:Addgene_167936) -
For your References section:
A functional genetic toolbox for human tissue-derived organoids. Sun D, Evans L, Perrone F, Sokleva V, Lim K, Rezakhani S, Lutolf M, Zilbauer M, Rawlins EL. eLife. 2021 Oct 6;10. pii: 67886. doi: 10.7554/eLife.67886. 10.7554/eLife.67886 PubMed 34612202