Lenti-sgZmat3.55.9/Cre
(Plasmid
#167853)
-
PurposeExpresses Cre recombinase and an sgRNA targeting Zmat3
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 167853 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLL3.3
- Total vector size (bp) 7762
-
Vector typeMammalian Expression, Mouse Targeting, Lentiviral, Cre/Lox, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA targeting Zmat3
-
Alt nameZmat3, Wig1, PAG608
-
gRNA/shRNA sequenceCTCCCCTGCCGTGGCAC
-
SpeciesM. musculus (mouse)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GGTACAGTGCAGGGGAAAGA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMonte Winslow, Stanford University
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti-sgZmat3.55.9/Cre was a gift from Laura Attardi (Addgene plasmid # 167853 ; http://n2t.net/addgene:167853 ; RRID:Addgene_167853) -
For your References section:
Zmat3 Is a Key Splicing Regulator in the p53 Tumor Suppression Program. Bieging-Rolett KT, Kaiser AM, Morgens DW, Boutelle AM, Seoane JA, Van Nostrand EL, Zhu C, Houlihan SL, Mello SS, Yee BA, McClendon J, Pierce SE, Winters IP, Wang M, Connolly AJ, Lowe SW, Curtis C, Yeo GW, Winslow MM, Bassik MC, Attardi LD. Mol Cell. 2020 Nov 5;80(3):452-469.e9. doi: 10.1016/j.molcel.2020.10.022. 10.1016/j.molcel.2020.10.022 PubMed 33157015