miniTol2 x EF1a_EKAREN4(TA) + PGK-puro
(Plasmid #167826)

• Purpose: Control sensor for EKAREN4
• Depositing Lab: Hugo Snippert
• Publication: Ponsioen et al Nat Cell Biol. 2021 Apr;23(4):377-390. doi: 10.1038/s41556-021-00654-5. Epub 2021 Apr 1.

Backbone

• Vector backbone: miniTol2 expression vector
• Backbone size w/o insert (bp): 3450
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EKAREN4(TA)
• Species: Synthetic
• Insert Size (bp): 1950
• Mutation: K424P, K426W, T420A
• Promoter: EF1a
• Tag / Fusion Protein:
  • nls localization motif (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TGGAATTTGCCCTTTTTGAG
• 3′ sequencing primer: AATGTTAACGACCGGt

Resource Information

• Supplemental Documents:
  • miniTol2 x EF1a_EKAREN4(TA) + PGK-puro.gb
• A portion of this plasmid was derived from a plasmid made by: EKAREV (Komatsu et al.)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

We received EKAREV FRET biosensor from Matsuda-lab (Japan). We subsequently improved by insertion of a Turquoise2 synthetic DNA, including 169 silent mutations (reducing recombination) and adapted the sensor domain by point mutagenesis. The generation of stable cell lines using this plasmid requires the co-transfection of a transposase-expressing plasmid. The depositing lab recommends the use of Plasmid 158774.