Skip to main content
Addgene

pLV x EF1a_EKAREN5-ires-blast
(Plasmid #167822)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 167822 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLV lentiviral vector
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EKAREN5
  • Species
    Synthetic
  • Insert Size (bp)
    1950
  • Mutation
    K424P, K426W
  • Promoter EF1a
  • Tag / Fusion Protein
    • nls localization motif (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TGGAATTTGCCCTTTTTGAG
  • 3′ sequencing primer AATGTTAACGACCGGt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

We received EKAREV FRET biosensor from Matsuda-lab (Japan). We subsequently improved by insertion of a Turquoise2 synthetic DNA, including 169 silent mutations (reducing recombination) and adapted the sensor domain by point mutagenesis.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV x EF1a_EKAREN5-ires-blast was a gift from Hugo Snippert (Addgene plasmid # 167822 ; http://n2t.net/addgene:167822 ; RRID:Addgene_167822)
  • For your References section:

    Quantifying single-cell ERK dynamics in colorectal cancer organoids reveals EGFR as an amplifier of oncogenic MAPK pathway signalling. Ponsioen B, Post JB, Buissant des Amorie JR, Laskaris D, van Ineveld RL, Kersten S, Bertotti A, Sassi F, Sipieter F, Cappe B, Mertens S, Verlaan-Klink I, Boj SF, Vries RGJ, Rehmann H, Vandenabeele P, Riquet FB, Trusolino L, Bos JL, Snippert HJG. Nat Cell Biol. 2021 Apr;23(4):377-390. doi: 10.1038/s41556-021-00654-5. Epub 2021 Apr 1. 10.1038/s41556-021-00654-5 PubMed 33795873