AAV-hSyn-Ribo-jGCaMP8m
(Plasmid #167574)

• Purpose: Please see Addgene item #169248 for an improved version of this plasmid. AAV transfer plasmid for neuronal expression of soma-targeted (RL-10, ribosomal tag) jGCaMP8m.
• Depositing Lab: Marianne Fyhn
• Publication: Grodem et al Nat Commun. 2023 Feb 4;14(1):608. doi: 10.1038/s41467-023-36324-3.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 2868
• Total vector size (bp): 6533
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Ribo-GCaMP8m
• Species: M. musculus (mouse), R. norvegicus (rat), G. gallus (chicken); A. victoria (jellyfish)
• Insert Size (bp): 1956
• Promoter: hSyn
• Tag / Fusion Protein:
  • 6xHis (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: HpaI (not destroyed)
• 5′ sequencing primer: TCGTGTCGTGCCTGAGAGCG
• 3′ sequencing primer: cagcgtatccacatagcgtaaa

Resource Information

• Supplemental Documents:
  • ribogcamp8m.gb
• A portion of this plasmid was derived from a plasmid made by: Ribo-tag from #158777, GCaMP8m from #162375.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry