pGFP-HBO1-G485A pc2201
(Plasmid
#167570)
-
PurposeThe human HBO1 is fused to C-terminal GFP of EGFP-C1 (Clontech)
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 167570 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4731
- Total vector size (bp) 6555
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehistone acetyltransferase 1
-
SpeciesH. sapiens (human)
-
MutationG485A
-
GenBank IDAF074606.1
-
Entrez GeneKAT7 (a.k.a. HBO1, HBOA, MYST2, ZC2HC7)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GACAAGGAGTACCTGAGC
- 3′ sequencing primer CTCTACAAATGTGGTATGGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGFP-HBO1-G485A pc2201 was a gift from Cristina Cardoso (Addgene plasmid # 167570 ; http://n2t.net/addgene:167570 ; RRID:Addgene_167570) -
For your References section:
DNA replication dynamics of vole genome and its epigenetic regulation. Heinz KS, Rapp A, Casas-Delucchi CS, Lehmkuhl A, Romero-Fernandez I, Sanchez A, Kramer OH, Marchal JA, Cardoso MC. Epigenetics Chromatin. 2019 Mar 14;12(1):18. doi: 10.1186/s13072-019-0262-0. 10.1186/s13072-019-0262-0 PubMed 30871586
Map uploaded by the depositor.
