pCENPBR pc861
(Plasmid
#167569)
-
PurposeHuman CENP-B (aa 1-169 containing DNA-binding domain) cloned into pDsRed1-N1 vector (Clontech).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 167569 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDsRed1-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 5190
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHomo sapiens centromere protein B
-
SpeciesH. sapiens (human)
-
GenBank IDNM_001810
-
Entrez GeneCENPB
- Promoter CMV
-
Tag
/ Fusion Protein
- Ds-Red (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HIndIII (not destroyed)
- 3′ cloning site BamHI (destroyed during cloning)
- 5′ sequencing primer CTGTCCCCCCAGTTCCAGTA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCENPBR pc861 was a gift from Cristina Cardoso (Addgene plasmid # 167569 ; http://n2t.net/addgene:167569 ; RRID:Addgene_167569) -
For your References section:
Processive DNA synthesis is associated with localized decompaction of constitutive heterochromatin at the sites of DNA replication and repair. Chagin VO, Reinhart B, Becker A, Mortusewicz O, Jost KL, Rapp A, Leonhardt H, Cardoso MC. Nucleus. 2019 Dec;10(1):231-253. doi: 10.1080/19491034.2019.1688932. 10.1080/19491034.2019.1688932 PubMed 31744372