Skip to main content
Addgene

pCENPBR pc861
(Plasmid #167569)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 167569 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pDsRed1-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 5190
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Homo sapiens centromere protein B
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_001810
  • Entrez Gene
    CENPB
  • Promoter CMV
  • Tag / Fusion Protein
    • Ds-Red (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HIndIII (not destroyed)
  • 3′ cloning site BamHI (destroyed during cloning)
  • 5′ sequencing primer CTGTCCCCCCAGTTCCAGTA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCENPBR pc861 was a gift from Cristina Cardoso (Addgene plasmid # 167569 ; http://n2t.net/addgene:167569 ; RRID:Addgene_167569)
  • For your References section:

    Processive DNA synthesis is associated with localized decompaction of constitutive heterochromatin at the sites of DNA replication and repair. Chagin VO, Reinhart B, Becker A, Mortusewicz O, Jost KL, Rapp A, Leonhardt H, Cardoso MC. Nucleus. 2019 Dec;10(1):231-253. doi: 10.1080/19491034.2019.1688932. 10.1080/19491034.2019.1688932 PubMed 31744372