Skip to main content
Addgene

pENmRFPCNAL2 pc1054
(Plasmid #167567)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 167567 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pEVRF
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Proliferating Cell Nuclear Antigen
  • Alt name
    PCNA
  • Species
    H. sapiens (human)
  • Entrez Gene
    PCNA (a.k.a. ATLD2)
  • Promoter CMV
  • Tag / Fusion Protein
    • mRFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site BsrGI (not destroyed)
  • 5′ sequencing primer AGCTGGACATCACCTCCCACAACG
    • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENmRFPCNAL2 pc1054 was a gift from Cristina Cardoso (Addgene plasmid # 167567 ; http://n2t.net/addgene:167567 ; RRID:Addgene_167567)

  • For your References section:

    PCNA acts as a stationary loading platform for transiently interacting Okazaki fragment maturation proteins. Sporbert A, Domaing P, Leonhardt H, Cardoso MC. Nucleic Acids Res. 2005 Jun 21;33(11):3521-8. doi: 10.1093/nar/gki665. Print 2005. 10.1093/nar/gki665 PubMed 15972794
Related items: