Skip to main content
Addgene

pMeCP2Y pc644
(Plasmid #167565)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 167565 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pEYFP-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 6245
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Methyl-CpG binding protein 2
  • Species
    R. norvegicus (rat)
  • Entrez Gene
    Mecp2 (a.k.a. MECP2_e1)
  • Promoter CMV
  • Tag / Fusion Protein
    • YFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer 5'd[CGTCGCCGTCCAGCTCGACCAG]3'
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMeCP2Y pc644 was a gift from Cristina Cardoso (Addgene plasmid # 167565 ; http://n2t.net/addgene:167565 ; RRID:Addgene_167565)

  • For your References section:

    Methyl CpG-binding proteins induce large-scale chromatin reorganization during terminal differentiation. Brero A, Easwaran HP, Nowak D, Grunewald I, Cremer T, Leonhardt H, Cardoso MC. J Cell Biol. 2005 Jun 6;169(5):733-43. doi: 10.1083/jcb.200502062. 10.1083/jcb.200502062 PubMed 15939760
Related items: