Skip to main content
Addgene

pENeCFPCNAL2 pc922
(Plasmid #167563)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 167563 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pEVRF
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Proliferating Cell Nuclear Antigen
  • Alt name
    PCNA
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_002592.2
  • Entrez Gene
    PCNA (a.k.a. ATLD2)

Gene/Insert 2

  • Gene/Insert name
    CFP
  • Species
    Aequoria victoria
  • Promoter CMV

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site BsrGI (not destroyed)
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENeCFPCNAL2 pc922 was a gift from Cristina Cardoso (Addgene plasmid # 167563 ; http://n2t.net/addgene:167563 ; RRID:Addgene_167563)

  • For your References section:

    Methyl-CpG binding domain protein 1 regulates localization and activity of Tet1 in a CXXC3 domain-dependent manner. Zhang P, Rausch C, Hastert FD, Boneva B, Filatova A, Patil SJ, Nuber UA, Gao Y, Zhao X, Cardoso MC. Nucleic Acids Res. 2017 Apr 25. doi: 10.1093/nar/gkx281. 10.1093/nar/gkx281 PubMed 28449087
Related items: