Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

HA, EGFP Spastin M87 with exon 4, N386C
(Plasmid #167543)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 167543 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA5/FRT/TO
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5137
  • Total vector size (bp) 7440
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Spastin M87 with exon 4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1593
  • Mutation
    N386C
  • GenBank ID
    NM_014946.3
  • Entrez Gene
    SPAST (a.k.a. ADPSP, FSP2, SPG4)
  • Promoter CMV
  • Tags / Fusion Proteins
    • HA tag (N terminal on backbone)
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HA, EGFP Spastin M87 with exon 4, N386C was a gift from Tarun Kapoor (Addgene plasmid # 167543 ; http://n2t.net/addgene:167543 ; RRID:Addgene_167543)
  • For your References section:

    Designing a chemical inhibitor for the AAA protein spastin using active site mutations. Cupido T, Pisa R, Kelley ME, Kapoor TM. Nat Chem Biol. 2019 May;15(5):444-452. doi: 10.1038/s41589-019-0225-6. Epub 2019 Feb 18. 10.1038/s41589-019-0225-6 PubMed 30778202