Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

His-TEV-PRC1
(Plasmid #167539)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 167539 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pETDuet-1
  • Backbone manufacturer
    EMD Biosciences
  • Backbone size w/o insert (bp) 5420
  • Total vector size (bp) 7099
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    IPTG inducible.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PRC1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1863
  • GenBank ID
    NP_003972
  • Entrez Gene
    PRC1 (a.k.a. ASE1, MAP65)
  • Promoter T7
  • Tag / Fusion Protein
    • His6 tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    His-TEV-PRC1 was a gift from Tarun Kapoor (Addgene plasmid # 167539 ; http://n2t.net/addgene:167539 ; RRID:Addgene_167539)
  • For your References section:

    Marking and measuring single microtubules by PRC1 and kinesin-4. Subramanian R, Ti SC, Tan L, Darst SA, Kapoor TM. Cell. 2013 Jul 18;154(2):377-90. doi: 10.1016/j.cell.2013.06.021. 10.1016/j.cell.2013.06.021 PubMed 23870126