Skip to main content
Addgene

pcDNA3.1-3XHA-Zmat3
(Plasmid #167343)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 167343 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5428
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Zinc finger matrin-type 3
  • Alt name
    Zmat3, Wig1, PAG608
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    900
  • Entrez Gene
    Zmat3 (a.k.a. Wig, Wig1)
  • Promoter CMV
  • Tag / Fusion Protein
    • 3HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Asc1 (not destroyed)
  • 3′ cloning site Pac1 (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-3XHA-Zmat3 was a gift from Laura Attardi (Addgene plasmid # 167343 ; http://n2t.net/addgene:167343 ; RRID:Addgene_167343)

  • For your References section:

    Zmat3 Is a Key Splicing Regulator in the p53 Tumor Suppression Program. Bieging-Rolett KT, Kaiser AM, Morgens DW, Boutelle AM, Seoane JA, Van Nostrand EL, Zhu C, Houlihan SL, Mello SS, Yee BA, McClendon J, Pierce SE, Winters IP, Wang M, Connolly AJ, Lowe SW, Curtis C, Yeo GW, Winslow MM, Bassik MC, Attardi LD. Mol Cell. 2020 Nov 5;80(3):452-469.e9. doi: 10.1016/j.molcel.2020.10.022. 10.1016/j.molcel.2020.10.022 PubMed 33157015
Related items:
Commonly requested with: