pCDH_blast_MCS_Nard_GFP_D50
(Plasmid #167339)

• Purpose: Expresses GFP fused to progerin (d50) in mammalian cells
• Depositing Lab: Tom Misteli
• Publication: Feric et al EMBO J. 2021 Mar 15;40(6):e107165. doi: 10.15252/embj.2020107165. Epub 2021 Feb 23.

Backbone

• Vector backbone: pCDH_blast_NCS_Nard
• Backbone size w/o insert (bp): 7208
• Total vector size (bp): 9812
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Progerin
• Alt name: LaminAd50
• Species: H. sapiens (human)
• Insert Size (bp): 2614
• Mutation: 50AA deletion creating Progerin instead of mature LMNA
• GenBank ID: AY357727.1
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: AAATGTCGTAACAACTCCGC
• 3′ sequencing primer: TCTCTAGGCACCCGTTCAAT

Resource Information

• Supplemental Documents:
  • BAC1534_pCDH_blast_MCS_Nard_GFP_D50_20200417.ape
• A portion of this plasmid was derived from a plasmid made by: Nard Kubben

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/822858v4 for BioRxiv preprint