pCDH_CMV_HMGA_mKate2
(Plasmid #167334)

• Purpose: Expresses mKate2 fused to TFAM HMGA mutant in mammalian cells
• Depositing Lab: Tom Misteli
• Publication: Feric et al EMBO J. 2021 Mar 15;40(6):e107165. doi: 10.15252/embj.2020107165. Epub 2021 Feb 23.

Backbone

• Vector backbone: pCDH-CMV-MCS
• Backbone manufacturer: Addgene
• Backbone size w/o insert (bp): 6227
• Total vector size (bp): 7290
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TFAM
• Alt name: Mitochondrial transcription factor A
• Species: H. sapiens (human)
• Insert Size (bp): 1089
• Mutation: Truncation mutant containing MTS (1-42) and HMGA domain (43-122)
• GenBank ID: NM_003201.3
• Entrez Gene: TFAM (a.k.a. MTDPS15, MTTF1, MTTFA, TCF6, TCF6L1, TCF6L2, TCF6L3)
• Promoter: CMV
• Tag / Fusion Protein:
  • mKate2 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xba (unknown if destroyed)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • BAC1525_pCDH_CMV_HMGA_mKate2.ape
• A portion of this plasmid was derived from a plasmid made by: Applied Biological Materials Inc. (abm)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The mKate2 gene was initially obtained from the commercially available plasmid: pLenti-GIII-CMV-TFAM-RFP-2A-Puro. Please visit https://www.biorxiv.org/content/10.1101/822858v4 for BioRxiv preprint