pCDH_CMV_L6_mKate2
(Plasmid
#167332)
-
PurposeExpresses mKate2 fused to TFAM L6 mutant in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 167332 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCDH-CMV-MCS
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 6227
- Total vector size (bp) 7662
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTFAM
-
Alt nameMitochondrial transcription factor A
-
SpeciesH. sapiens (human)
-
MutationChanged K136, H137, K139, R140, K146 and K147 to alanine
-
GenBank IDNM_003201.3
- Promoter CMV
-
Tag
/ Fusion Protein
- mKate2 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xba (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byAddgene; Applied Biological Materials Inc. (abm)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The L6 mutant TFAM gene was originally obtained from Addgene Plasmid #60012. The mKate2 gene was initially obtained from the commercially available plasmid: pLenti-GIII-CMV-TFAM-RFP-2A-Puro. Please visit https://www.biorxiv.org/content/10.1101/822858v4 for BioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH_CMV_L6_mKate2 was a gift from Tom Misteli (Addgene plasmid # 167332 ; http://n2t.net/addgene:167332 ; RRID:Addgene_167332) -
For your References section:
Self-assembly of multi-component mitochondrial nucleoids via phase separation. Feric M, Demarest TG, Tian J, Croteau DL, Bohr VA, Misteli T. EMBO J. 2021 Mar 15;40(6):e107165. doi: 10.15252/embj.2020107165. Epub 2021 Feb 23. 10.15252/embj.2020107165 PubMed 33619770