pcDNA3.1-ecDHFR(DD)-MS2CP-VPg(FCV)
(Plasmid
#167313)
-
PurposeTemplate pDNA to prepare DD-CaVT mRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 167313 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1+/C-(K)DYK
-
Backbone manufacturerGenscript
- Total vector size (bp) 6581
-
Vector typeMammalian Expression, Synthetic Biology
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDD-CaVT
-
Alt nameFusion protein of ecDHFR-derived destabilizing domain, MS2 coat protein, and Feline Calicivirus VPg protein
-
SpeciesSynthetic
-
Insert Size (bp)1233
- Promoter CMV
-
Tag
/ Fusion Protein
- DYK-tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (destroyed during cloning)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer T7 promoter (TAATACGACTCACTATAGGG)
- 3′ sequencing primer TCACTTATCGTCGTCATCCTTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-ecDHFR(DD)-MS2CP-VPg(FCV) was a gift from Hirohide Saito (Addgene plasmid # 167313 ; http://n2t.net/addgene:167313 ; RRID:Addgene_167313) -
For your References section:
Light-controllable RNA-protein devices for translational regulation of synthetic mRNAs in mammalian cells. Nakanishi H, Yoshii T, Kawasaki S, Hayashi K, Tsutsui K, Oki C, Tsukiji S, Saito H. Cell Chem Biol. 2021 Jan 20. pii: S2451-9456(21)00002-7. doi: 10.1016/j.chembiol.2021.01.002. 10.1016/j.chembiol.2021.01.002 PubMed 33508227