pBCMV-MS2CP-eDHFR
(Plasmid
#167309)
-
PurposeTemplate pDNA to prepare a split CaVT component mRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 167309 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1+/C-(K)DYK (partial)
-
Backbone manufacturerGenscript
- Total vector size (bp) 7510
-
Modifications to backboneOutside of CMV promoter-Kan/Neo resistance gene region is replaced by the piggyBac vector-derived sequence.
-
Vector typeMammalian Expression, Synthetic Biology
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMS2CP-eDHFR
-
Alt nameFusion protein of MS2 coat protein and Escherichia coli dihydrofolate reductase
-
SpeciesSynthetic
-
Insert Size (bp)876
- Promoter CMV
-
Tag
/ Fusion Protein
- DYK-tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer None
- 3′ sequencing primer TCACTTATCGTCGTCATCCTTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBCMV-MS2CP-eDHFR was a gift from Hirohide Saito (Addgene plasmid # 167309 ; http://n2t.net/addgene:167309 ; RRID:Addgene_167309) -
For your References section:
Light-controllable RNA-protein devices for translational regulation of synthetic mRNAs in mammalian cells. Nakanishi H, Yoshii T, Kawasaki S, Hayashi K, Tsutsui K, Oki C, Tsukiji S, Saito H. Cell Chem Biol. 2021 Jan 20. pii: S2451-9456(21)00002-7. doi: 10.1016/j.chembiol.2021.01.002. 10.1016/j.chembiol.2021.01.002 PubMed 33508227