pBCMV-MS2CP-eDHFR
(Plasmid #167309)

• Purpose: Template pDNA to prepare a split CaVT component mRNA
• Depositing Lab: Hirohide Saito
• Publication: Nakanishi et al Cell Chem Biol. 2021 Jan 20. pii: S2451-9456(21)00002-7. doi: 10.1016/j.chembiol.2021.01.002.

Backbone

• Vector backbone: pcDNA3.1+/C-(K)DYK (partial)
• Backbone manufacturer: Genscript
• Total vector size (bp): 7510
• Modifications to backbone: Outside of CMV promoter-Kan/Neo resistance gene region is replaced by the piggyBac vector-derived sequence.
• Vector type: Mammalian Expression, Synthetic Biology
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: MS2CP-eDHFR
• Alt name: Fusion protein of MS2 coat protein and Escherichia coli dihydrofolate reductase
• Species: Synthetic
• Insert Size (bp): 876
• Promoter: CMV
• Tag / Fusion Protein:
  • DYK-tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: AgeI (not destroyed)
• 5′ sequencing primer: None
• 3′ sequencing primer: TCACTTATCGTCGTCATCCTTG

Resource Information

• Supplemental Documents:
  • pBCMV-MS2CP-eDHFR

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry