Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSpCas9nucl-T2A-mCherry - BAKgRNA1- BAKgRNA2
(Plasmid #167295)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 167295 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PX458
  • Total vector size (bp) 9720
  • Modifications to backbone
    Inserted a second U6 gRNA expression cassette
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BAK
  • gRNA/shRNA sequence
    GCATGAAGTCGACCACGAAG, GGCCATGCTGGTAGACGTGT
  • Species
    H. sapiens (human)
  • Entrez Gene
    BAK1 (a.k.a. BAK, BAK-LIKE, BCL2L7, CDN1)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSpCas9nucl-T2A-mCherry - BAKgRNA1- BAKgRNA2 was a gift from Agnel Sfeir (Addgene plasmid # 167295 ; http://n2t.net/addgene:167295 ; RRID:Addgene_167295)
  • For your References section:

    Nuclear sensing of breaks in mitochondrial DNA enhances immune surveillance. Tigano M, Vargas DC, Tremblay-Belzile S, Fu Y, Sfeir A. Nature. 2021 Mar;591(7850):477-481. doi: 10.1038/s41586-021-03269-w. Epub 2021 Feb 24. 10.1038/s41586-021-03269-w PubMed 33627873