Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTRIP-SFFV-mtagBFP-2A RIGI K270A
(Plasmid #167290)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 167290 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTRIP-SFFV
  • Backbone size w/o insert (bp) 10356
  • Total vector size (bp) 13134
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    TagBFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DDX58
  • Alt name
    RIG-I
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2778
  • Mutation
    K270A
  • Entrez Gene
    RIGI (a.k.a. DDX58, RIG-I, RIG1, RLR-1, SGMRT2)
  • Promoter SFFV
  • Tag / Fusion Protein
    • tagBFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer cgcttctgcttcccgagctc
  • 3′ sequencing primer cttctagccaggcacaatcagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTRIP-SFFV-mtagBFP-2A RIGI K270A was a gift from Agnel Sfeir (Addgene plasmid # 167290 ; http://n2t.net/addgene:167290 ; RRID:Addgene_167290)
  • For your References section:

    Nuclear sensing of breaks in mitochondrial DNA enhances immune surveillance. Tigano M, Vargas DC, Tremblay-Belzile S, Fu Y, Sfeir A. Nature. 2021 Mar;591(7850):477-481. doi: 10.1038/s41586-021-03269-w. Epub 2021 Feb 24. 10.1038/s41586-021-03269-w PubMed 33627873