pTRIP-SFFV-mtagBFP-2A RIGI WT
(Plasmid #167289)

• Purpose: Lentiviral expression construct encoding a TagBFP in frame with a self-cleaving wild-type RLR sensor RIG-I
• Depositing Lab: Agnel Sfeir
• Publication: Tigano et al Nature. 2021 Mar;591(7850):477-481. doi: 10.1038/s41586-021-03269-w. Epub 2021 Feb 24.

Backbone

• Vector backbone: pTRIP-SFFV
• Backbone size w/o insert (bp): 10356
• Total vector size (bp): 13134
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: TagBFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: DDX58
• Species: H. sapiens (human)
• Insert Size (bp): 2778
• Entrez Gene: RIGI (a.k.a. DDX58, RIG-I, RIG1, RLR-1, SGMRT2)
• Promoter: SFFV
• Tag / Fusion Protein:
  • tagBFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: XhoI (unknown if destroyed)
• 5′ sequencing primer: cgcttctgcttcccgagctc
• 3′ sequencing primer: cttctagccaggcacaatcagc

Resource Information

• Supplemental Documents:
  • pTRIP-SFFV-mtagBFP-2A RIGI WT.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2020.01.31.929075v1 for bioRxiv preprint.