pDS1928
(Plasmid #167284)

• Purpose: Expression plasmid for Candida albicans containing a red-shifted luciferase
• Depositing Lab: Dominique Sanglard
• Publication: Dorsaz et al Front Microbiol. 2017 Aug 3;8:1478. doi: 10.3389/fmicb.2017.01478. eCollection 2017.

Backbone

• Vector backbone: pBluescript
• Selectable markers: Nourseothricin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: red shifted luciferase
• Species: Synthetic
• Insert Size (bp): 1653
• Promoter: ACT1

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: PstI (not destroyed)
• 5′ sequencing primer: AATTAACCCTCACTAAAGGG
• 3′ sequencing primer: CGTTCTTAATACTAACATAACT

Gene/Insert 2

• Gene/Insert name: SAT1
• Alt name: dominant marker
• Insert Size (bp): 1828
• Promoter: ACT1

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (destroyed during cloning)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: TTTAAGGATAATGATCTGGG
• 3′ sequencing primer: CGACTCACTATAGGGCGAAT

Resource Information

• Supplemental Documents:
  • pDS1928.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry