pJAK184
(Plasmid #167281)

• Purpose: (Empty Backbone) MazF-based mutagenesis vector for C. difficile
• Depositing Lab: Robert Fagan
• Publication: Fuchs et al Proc Natl Acad Sci U S A. 2021 Jun 22;118(25). pii: 2103579118. doi: 10.1073/pnas.2103579118.

Backbone

• Vector backbone: pMTLSC-7215
• Backbone manufacturer: Nigel P Minton
• Backbone size (bp): 6768
• Modifications to backbone: Plasmid pJAK112 (Addgene Plasmid 167280) was modified to replace the codA gene with a xylose-inducible mazF. The xylB promoter and adjacent xylR (Pxyl) were amplified from C. difficile strain R20291 using oligonucleotides RF1589 (GATCGGTACCGGTTATGGCTGTATATAGTCATAAC) and RF1590 (GATCGAGCTCGAATGCCACTTCATAACTATCGTTTTC) and inserted into pRPF185 using KpnI/SacI restriction-ligation. E. coli mazF was codon optimised for C. difficile, synthesised (FragmentGENE by Genewiz) and inserted into the resulting plasmid via SacI/BamHI restriction-ligation. Pxly-mazF was then amplified using oligonucleotides RF1704 (GATCGCGGCCGCGCTGTATATAGTCATAACCCTTATATTTC) and RF1705 (GATCCTCGAGGAGAGTTGTTGATTTATCCAATTAATAC) and inserted into pJAK112 using NotI/XhoI restriction-ligation resulting in pJAK183. The SacI site upstream of mazF was then removed by inverse PCR (RF1718, GCCACTTCATAACTATCGTTTTCC / RF1719, GCAGTAAAGGAGAAAATTTTATGGTAAG) resulting in pJAK184.
• Vector type: E. coli - C. difficile shuttle vector
• Promoter: Pxyl

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Low copy in C. difficile following conjugation and selected with thiamphenicol
• Copy number: High Copy

Cloning Information

• Cloning method: Gibson Cloning

Resource Information

• Supplemental Documents:
  • pJAK184.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry