Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJAK184
(Plasmid #167281)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 167281 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMTLSC-7215
  • Backbone manufacturer
    Nigel P Minton
  • Backbone size (bp) 6768
  • Modifications to backbone
    Plasmid pJAK112 (Addgene Plasmid 167280) was modified to replace the codA gene with a xylose-inducible mazF. The xylB promoter and adjacent xylR (Pxyl) were amplified from C. difficile strain R20291 using oligonucleotides RF1589 (GATCGGTACCGGTTATGGCTGTATATAGTCATAAC) and RF1590 (GATCGAGCTCGAATGCCACTTCATAACTATCGTTTTC) and inserted into pRPF185 using KpnI/SacI restriction-ligation. E. coli mazF was codon optimised for C. difficile, synthesised (FragmentGENE by Genewiz) and inserted into the resulting plasmid via SacI/BamHI restriction-ligation. Pxly-mazF was then amplified using oligonucleotides RF1704 (GATCGCGGCCGCGCTGTATATAGTCATAACCCTTATATTTC) and RF1705 (GATCCTCGAGGAGAGTTGTTGATTTATCCAATTAATAC) and inserted into pJAK112 using NotI/XhoI restriction-ligation resulting in pJAK183. The SacI site upstream of mazF was then removed by inverse PCR (RF1718, GCCACTTCATAACTATCGTTTTCC / RF1719, GCAGTAAAGGAGAAAATTTTATGGTAAG) resulting in pJAK184.
  • Vector type
    E. coli - C. difficile shuttle vector
  • Promoter Pxyl

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Low copy in C. difficile following conjugation and selected with thiamphenicol
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJAK184 was a gift from Robert Fagan (Addgene plasmid # 167281 ; http://n2t.net/addgene:167281 ; RRID:Addgene_167281)
  • For your References section:

    An RNA-centric global view of Clostridioides difficile reveals broad activity of Hfq in a clinically important gram-positive bacterium. Fuchs M, Lamm-Schmidt V, Sulzer J, Ponath F, Jenniches L, Kirk JA, Fagan RP, Barquist L, Vogel J, Faber F. Proc Natl Acad Sci U S A. 2021 Jun 22;118(25). pii: 2103579118. doi: 10.1073/pnas.2103579118. 10.1073/pnas.2103579118 PubMed 34131082