pJAK112
(Plasmid #167280)

• Purpose: (Empty Backbone) CodA-based mutagenesis vector for C. difficile
• Depositing Lab: Robert Fagan
• Publication: Fuchs et al Proc Natl Acad Sci U S A. 2021 Jun 22;118(25). pii: 2103579118. doi: 10.1073/pnas.2103579118.

Backbone

• Vector backbone: pMTLSC-7215
• Backbone manufacturer: Nigel P Minton
• Backbone size (bp): 6768
• Modifications to backbone: BamHI, SacI, and KpnI restriction sites were first removed from pMTLSC-7215 (doi:10.1128/AEM.00249-12) by inverse PCR cloning (RF851, CTAGAGTCGACGTCACGCG/RF852, GAATTCGCCCTTTAAACTAAGCTC). The resulting plasmid was linearised by PCR using oligonucleotides RF1065 (GATCGAGCTCTAGGGTAACAAAAAACACCG) and RF1066 (GATCGGATCCCCTTTTTGATAATCTCATGACC), adding new terminal SacI and BamHI sites. Homology arms upstream and downstream of the slpA gene were amplified using oligonucleotides RF1025 (TATATTATTATATTTATACCCAAGCATATGAGTTTTTATAC) / RF1067 (GATCGAGCTCTATACAGGTGAAGCAGATGC) and RF1026 (ACTCATATGCTTGGGTATAAATATAATAATATAAAAAGGCTTCTTATATG ) / RF1068 (GATCGGATCCCTCTTCCTGTAAATTCGTCAAC), respectively, joined by SOEing PCR and combined with the linearised vector by SacI/BamHI restriction ligation resulting in pJAK112.
• Vector type: E. coli - C. difficile shuttle vector

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Low copy in C. difficile following conjugation and selected with thiamphenicol
• Copy number: High Copy

Resource Information

• Supplemental Documents:
  • pJAK112.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry