Skip to main content
Addgene

pJAK112
(Plasmid #167280)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 167280 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMTLSC-7215
  • Backbone manufacturer
    Nigel P Minton
  • Backbone size (bp) 6768
  • Modifications to backbone
    BamHI, SacI, and KpnI restriction sites were first removed from pMTLSC-7215 (doi:10.1128/AEM.00249-12) by inverse PCR cloning (RF851, CTAGAGTCGACGTCACGCG/RF852, GAATTCGCCCTTTAAACTAAGCTC). The resulting plasmid was linearised by PCR using oligonucleotides RF1065 (GATCGAGCTCTAGGGTAACAAAAAACACCG) and RF1066 (GATCGGATCCCCTTTTTGATAATCTCATGACC), adding new terminal SacI and BamHI sites. Homology arms upstream and downstream of the slpA gene were amplified using oligonucleotides RF1025 (TATATTATTATATTTATACCCAAGCATATGAGTTTTTATAC) / RF1067 (GATCGAGCTCTATACAGGTGAAGCAGATGC) and RF1026 (ACTCATATGCTTGGGTATAAATATAATAATATAAAAAGGCTTCTTATATG ) / RF1068 (GATCGGATCCCTCTTCCTGTAAATTCGTCAAC), respectively, joined by SOEing PCR and combined with the linearised vector by SacI/BamHI restriction ligation resulting in pJAK112.
  • Vector type
    E. coli - C. difficile shuttle vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Low copy in C. difficile following conjugation and selected with thiamphenicol
  • Copy number
    High Copy

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJAK112 was a gift from Robert Fagan (Addgene plasmid # 167280 ; http://n2t.net/addgene:167280 ; RRID:Addgene_167280)
  • For your References section:

    An RNA-centric global view of Clostridioides difficile reveals broad activity of Hfq in a clinically important gram-positive bacterium. Fuchs M, Lamm-Schmidt V, Sulzer J, Ponath F, Jenniches L, Kirk JA, Fagan RP, Barquist L, Vogel J, Faber F. Proc Natl Acad Sci U S A. 2021 Jun 22;118(25). pii: 2103579118. doi: 10.1073/pnas.2103579118. 10.1073/pnas.2103579118 PubMed 34131082