FASTHDR-Cterm-mTagBFP2-Blasticidin
(Plasmid #167207)

• Purpose: (Empty Backbone) Plasmid to clone recombination arms to create homologous recombination donor vector for C-terminal gene tagging with mTagBFP2 and selection with Blasticidin
• Depositing Lab: Oscar Perez
• Publication: Perez-Leal et al CRISPR J. 2021 Nov 30. doi: 10.1089/crispr.2021.0041.

Backbone

• Vector backbone: puc57
• Backbone size (bp): 2458
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: Blasticidin
• Tag / Fusion Protein:
  • mTagBFP2 (C terminal on insert)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DB3.1
• Growth instructions: The empty plasmid must be maintained in E.coli DB3.1. Once the plasmid is used to insert homologous recombination arms, the plasmid must be transformed in a strain that is sensitive to ccdb such as DH5Alpha or similar.
• Copy number: High Copy

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gcagattgtactgagagtgcaccata
• 3′ sequencing primer: caggttttgctttttggcctttccc

Resource Information

• Supplemental Documents:
  • FAST-HDR Vector System User Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry