pSiMPls_N + pSiMPls_C
(Plasmid #167203)

• Purpose: SiMPl plasmid pair (pSiMPls) for use with spectinomycin/streptomycin
• Depositing Lab: Barbara Di Ventura
• Publication: Palanisamy et al ACS Omega. 2021 May 21;6(22):14148-14153. doi: 10.1021/acsomega.1c00649. eCollection 2021 Jun 8.

Backbone

• Vector backbone: pBAD33 + pTrc99a
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: pSiMPls_N should be co-transformed with pSiMPls_C (or vice versa) in E. coli to get a reconstituted functional aminoglycoside adenylyltransferase thereby conferring resistance towards spectinomycin/streptomycin. The plasmids possess no additional antibiotic resistance gene. Please see the Sequences link for the individual plasmid sequences. An E. coli bacterial stab from Addgene will have both the plasmids pSiMPls_N + pSiMPls_C. Separating individual plasmid backbones will be possible via PCR. Agarose gel electrophoresis can be used to visualize the presence of both the plasmids. But, separating individual plasmids via gel electrophoresis, in our hands, always resulted in cross-contamination of the two backbones. mRuby3 gene was amplified from a construct bought by us from Addgene (ID: 74252).
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: EGFP
• Insert Size (bp): 720
• Promoter: pBAD

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacI (unknown if destroyed)
• 3′ cloning site: HindIII (unknown if destroyed)
• 5′ sequencing primer: gcacggcgtcacactttgctatgcc

Gene/Insert 2

• Gene/Insert name: SmR 1-75 + gp41-1 N-intein
• Species: Synthetic
• Insert Size (bp): 492
• Promoter: CAT

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ccaactttcaccataatgaaataagatcactaccgggcg

Gene/Insert 3

• Gene/Insert name: mRuby3
• Insert Size (bp): 711
• Promoter: pTrc

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: HindIII (unknown if destroyed)
• 5′ sequencing primer: ttgacaattaatcatccggctcgtataatg

Gene/Insert 4

• Gene/Insert name: gp41-1 C-intein + SmR 76-263
• Species: Synthetic
• Insert Size (bp): 678
• Promoter: AmpR

Cloning Information for Gene/Insert 4

• Cloning method: Gibson Cloning
• 5′ sequencing primer: NA
• 3′ sequencing primer: gaagttttaaatcaatctaaagtatatatgag

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pSiMPls_N should be co-transformed with pSiMPls_C (or vice versa) in E. coli to get a reconstituted functional aminoglycoside adenylyltransferase thereby conferring resistance towards spectinomycin/streptomycin. The plasmids possess no additional antibiotic resistance gene.

Please see the Sequences link for the individual plasmid sequences.

An E. coli bacterial stab from Addgene will have both the plasmids pSiMPls_N + pSiMPls_C. Separating individual plasmid backbones will be possible via PCR. Agarose gel electrophoresis can be used to visualize the presence of both the plasmids. But, separating individual plasmids via gel electrophoresis, in our hands, always resulted in cross-contamination of the two backbones.

mRuby3 gene was amplified from a construct bought by us from Addgene (ID: 74252).