S+10subs
(Plasmid
#167176)
-
PurposeExpresses the full Leptodactylus latrans Na+K+ATPase with ATP1A1-S variant with 10 R mutations in Sf9 cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 167176 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFastBac Dual
-
Backbone manufacturerThermo Fisher
- Backbone size w/o insert (bp) 5193
- Total vector size (bp) 9177
-
Vector typeBacterial Expression, Insect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsPlease note XL10-Gold used in this study
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameATP1A1-S+10R
-
Alt nameATP1A1
-
Alt nameNa+K+ATPase alpha 1
-
SpeciesLeptodactylus latrans
-
Insert Size (bp)3069
-
MutationChanged A at 112 to T; E at 116 to D; I at 135 to V; L at 180 to Q; I at 199 to L; I at 279 to V; S at 403 to C; L at 536 to M; Q at 701 to L; I at 788 to M
- Promoter PH
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer ATTCCGGATTATTCATACCGTCCCACCATCG
- 3′ sequencing primer GTGGTATGGCTGATTATGATCCTCTAGTACTTCTC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameATP1B1
-
Alt nameNa+K+ATPase beta 1
-
SpeciesLeptodactylus latrans
-
Insert Size (bp)915
- Promoter P10
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site KpnI (unknown if destroyed)
- 5′ sequencing primer CGGGTTCCTTCCGGTATTGTCTCCTTC
- 3′ sequencing primer ACGGACCTTTAATTCAACCCAACACAATATA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
S+10subs was a gift from Susanne Dobler (Addgene plasmid # 167176 ; http://n2t.net/addgene:167176 ; RRID:Addgene_167176) -
For your References section:
Concerted evolution reveals co-adapted amino acid substitutions in Na(+)K(+)-ATPase of frogs that prey on toxic toads. Mohammadi S, Yang L, Harpak A, Herrera-Alvarez S, Del Pilar Rodriguez-Ordonez M, Peng J, Zhang K, Storz JF, Dobler S, Crawford AJ, Andolfatto P. Curr Biol. 2021 Jun 21;31(12):2530-2538.e10. doi: 10.1016/j.cub.2021.03.089. Epub 2021 Apr 21. 10.1016/j.cub.2021.03.089 PubMed 33887183