Skip to main content
Addgene

pEGFP humanAPOBEC1 L173A/G227A
(Plasmid #167171)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 167171 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-C3
  • Backbone size w/o insert (bp) 3988
  • Total vector size (bp) 4677
  • Modifications to backbone
    EGFP protein was removed
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    humanAPOBEC1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    711
  • Mutation
    changed Leucine 173 to Alanine; changed Glycine 227 to Alanine
  • Entrez Gene
    APOBEC1 (a.k.a. APO1, APOBEC-1, BEDP, CDAR1, HEPR)
  • Promoter CMV promoter

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGTGTACGGTGGGAGGTCTA
  • 3′ sequencing primer TTCAGGTTCAGGGGGAGGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP humanAPOBEC1 L173A/G227A was a gift from Silvestro Conticello (Addgene plasmid # 167171 ; http://n2t.net/addgene:167171 ; RRID:Addgene_167171)
  • For your References section:

    Dimerisation of APOBEC1 is dispensable for its RNA editing activity. Chieca M, Montini M, Severi F, Pecori R, Conticello S. bioRxiv 2021 10.1101/410803