Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pX028
(Plasmid #167151)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 167151 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Level1-like (position 2)
  • Backbone size w/o insert (bp) 4372
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    p35s-nnHispS-ocsT
  • Species
    Neonothopanus nambi
  • Insert Size (bp)
    6103
  • Promoter p35s

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer ggtggcaggatatattgtggtgtaaac
  • 3′ sequencing primer ttcacgcccttttaaatatcc
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Synthetic

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX028 was a gift from Karen Sarkisyan (Addgene plasmid # 167151 ; http://n2t.net/addgene:167151 ; RRID:Addgene_167151)
  • For your References section:

    Plants with genetically encoded autoluminescence. Mitiouchkina T, Mishin AS, Somermeyer LG, Markina NM, Chepurnyh TV, Guglya EB, Karataeva TA, Palkina KA, Shakhova ES, Fakhranurova LI, Chekova SV, Tsarkova AS, Golubev YV, Negrebetsky VV, Dolgushin SA, Shalaev PV, Shlykov D, Melnik OA, Shipunova VO, Deyev SM, Bubyrev AI, Pushin AS, Choob VV, Dolgov SV, Kondrashov FA, Yampolsky IV, Sarkisyan KS. Nat Biotechnol. 2020 Apr 27. pii: 10.1038/s41587-020-0500-9. doi: 10.1038/s41587-020-0500-9. 10.1038/s41587-020-0500-9 PubMed 32341562