Skip to main content
Addgene

pX018
(Plasmid #167144)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 167144 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    Level0-SP-like
  • Backbone size w/o insert (bp) 2244
  • Vector type
    Luciferase, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    fungal luciferase, nnLuz
  • Species
    Neonothopanus nambi
  • Insert Size (bp)
    807

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer gagcgaggaagcggaagagcgccc
  • 3′ sequencing primer accattattatcatgacattaacc
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Synthetic

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX018 was a gift from Karen Sarkisyan (Addgene plasmid # 167144 ; http://n2t.net/addgene:167144 ; RRID:Addgene_167144)

  • For your References section:

    Plants with genetically encoded autoluminescence. Mitiouchkina T, Mishin AS, Somermeyer LG, Markina NM, Chepurnyh TV, Guglya EB, Karataeva TA, Palkina KA, Shakhova ES, Fakhranurova LI, Chekova SV, Tsarkova AS, Golubev YV, Negrebetsky VV, Dolgushin SA, Shalaev PV, Shlykov D, Melnik OA, Shipunova VO, Deyev SM, Bubyrev AI, Pushin AS, Choob VV, Dolgov SV, Kondrashov FA, Yampolsky IV, Sarkisyan KS. Nat Biotechnol. 2020 Apr 27. pii: 10.1038/s41587-020-0500-9. doi: 10.1038/s41587-020-0500-9. 10.1038/s41587-020-0500-9 PubMed 32341562
Related items:
Commonly requested with: