p35S_GFP-GUS
(Plasmid #167122)

• Purpose: Plant binary expression vector containing mGFP5-GUS fusion reporter under CaMV 35S promoter.
• Depositing Labs: Arturo Marí-Ordóñez, Olivier Voinnet
• Publication: Oberlin et al Genome Res. 2017 Sep;27(9):1549-1562. doi: 10.1101/gr.220723.117. Epub 2017 Aug 7.

Backbone

• Vector backbone: pB7m34GW
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 8000
• Total vector size (bp): 11934
• Vector type: Plant Expression
• Selectable markers: Basta

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GFP-GUS
• Alt name: mGFP5
• Alt name: beta-glucuronidase
• Insert Size (bp): 2562
• GenBank ID:
• Promoter: CaMV 35S
• Tag / Fusion Protein:
  • mGFP5, GUS

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: TTCGACGGAGAAGGTGACGATAC
• 3′ sequencing primer: TTGGTGAAGATATCCGCCAACTG

Resource Information

• Supplemental Documents:
  • 35S_GFP-GUS.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry